<?xml version="1.0" encoding="UTF-8"?><rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	
	xmlns:georss="http://www.georss.org/georss"
	xmlns:geo="http://www.w3.org/2003/01/geo/wgs84_pos#"
	
	>
<channel>
	<title>
	תגובות לפוסט: עד העונג הבא: תת מודע מחשבי	</title>
	<atom:link href="https://haoneg.com/temp/458/feed" rel="self" type="application/rss+xml" />
	<link>https://haoneg.com/temp/458</link>
	<description>מוזיקה. תרבות. לינקים. אינטרנט. מאת גיאחה</description>
	<lastBuildDate>Tue, 07 Oct 2008 10:57:27 +0000</lastBuildDate>
	<sy:updatePeriod>
	hourly	</sy:updatePeriod>
	<sy:updateFrequency>
	1	</sy:updateFrequency>
	<generator>https://wordpress.org/?v=6.1.7</generator>
	<item>
		<title>
		מאת: גיאחה		</title>
		<link>https://haoneg.com/temp/458#comment-180475</link>

		<dc:creator><![CDATA[גיאחה]]></dc:creator>
		<pubDate>Tue, 07 Oct 2008 10:57:18 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180475</guid>

					<description><![CDATA[ו... נראה לי שנעצור במאה. תודה לכל המגיבים התת-מודעיים!]]></description>
			<content:encoded><![CDATA[<p>ו&#8230; נראה לי שנעצור במאה. תודה לכל המגיבים התת-מודעיים!</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: אלריק		</title>
		<link>https://haoneg.com/temp/458#comment-180469</link>

		<dc:creator><![CDATA[אלריק]]></dc:creator>
		<pubDate>Tue, 07 Oct 2008 10:49:12 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180469</guid>

					<description><![CDATA[GGGCATATGGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGCATGGGTCGCCCGACAGAACGACGCCCGGCCGCCGC

(חתיכה של DNA שהזמנתי ועלתה לאונ&#039; בן גוריון 282.60 ש&quot;ח כולל מע&quot;מ)]]></description>
			<content:encoded><![CDATA[<p>GGGCATATGGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGCATGGGTCGCCCGACAGAACGACGCCCGGCCGCCGC</p>
<p>(חתיכה של DNA שהזמנתי ועלתה לאונ' בן גוריון 282.60 ש&quot;ח כולל מע&quot;מ)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: אלריק		</title>
		<link>https://haoneg.com/temp/458#comment-180468</link>

		<dc:creator><![CDATA[אלריק]]></dc:creator>
		<pubDate>Tue, 07 Oct 2008 10:48:55 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180468</guid>

					<description><![CDATA[GGGCATATGGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGCATGGGTCGCCCGACAGAACGACGCCCGGCCGCCGC

(חתיכה של DNA שהזמנתי ועלתה לאונ&#039; בן גוריון 282.60 כולל מע&quot;מ)]]></description>
			<content:encoded><![CDATA[<p>GGGCATATGGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGCATGGGTCGCCCGACAGAACGACGCCCGGCCGCCGC</p>
<p>(חתיכה של DNA שהזמנתי ועלתה לאונ' בן גוריון 282.60 כולל מע&quot;מ)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: רועי		</title>
		<link>https://haoneg.com/temp/458#comment-180440</link>

		<dc:creator><![CDATA[רועי]]></dc:creator>
		<pubDate>Tue, 07 Oct 2008 09:28:29 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180440</guid>

					<description><![CDATA[ccrma.stanford.edu]]></description>
			<content:encoded><![CDATA[<p>ccrma.stanford.edu</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: אלון		</title>
		<link>https://haoneg.com/temp/458#comment-180254</link>

		<dc:creator><![CDATA[אלון]]></dc:creator>
		<pubDate>Sun, 05 Oct 2008 18:52:06 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180254</guid>

					<description><![CDATA[ולאנמיה. כתישת זרעים קלויים לריפוי פצעים ולהפסקת דימום מהאף.]]></description>
			<content:encoded><![CDATA[<p>ולאנמיה. כתישת זרעים קלויים לריפוי פצעים ולהפסקת דימום מהאף.</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: amir		</title>
		<link>https://haoneg.com/temp/458#comment-180246</link>

		<dc:creator><![CDATA[amir]]></dc:creator>
		<pubDate>Sun, 05 Oct 2008 13:10:58 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180246</guid>

					<description><![CDATA[Conversations with Other Women 

(סרט רע, רע רע)]]></description>
			<content:encoded><![CDATA[<p>Conversations with Other Women </p>
<p>(סרט רע, רע רע)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: rooster		</title>
		<link>https://haoneg.com/temp/458#comment-180244</link>

		<dc:creator><![CDATA[rooster]]></dc:creator>
		<pubDate>Sun, 05 Oct 2008 12:56:24 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180244</guid>

					<description><![CDATA[לבקשת עודד נונברג-
התקנת 
IXOS Viewer 
למשתמש 
לפי הנוהל בלינק הבא:]]></description>
			<content:encoded><![CDATA[<p>לבקשת עודד נונברג-<br />
התקנת<br />
IXOS Viewer<br />
למשתמש<br />
לפי הנוהל בלינק הבא:</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: שירה		</title>
		<link>https://haoneg.com/temp/458#comment-180243</link>

		<dc:creator><![CDATA[שירה]]></dc:creator>
		<pubDate>Sun, 05 Oct 2008 12:38:38 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180243</guid>

					<description><![CDATA[Napoleon Dynamite (2004)]]></description>
			<content:encoded><![CDATA[<p>Napoleon Dynamite (2004)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: מני		</title>
		<link>https://haoneg.com/temp/458#comment-180242</link>

		<dc:creator><![CDATA[מני]]></dc:creator>
		<pubDate>Sun, 05 Oct 2008 10:35:54 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180242</guid>

					<description><![CDATA[תוכניות חדשות

(קשור לעבודה..לא מעניין בכלל)]]></description>
			<content:encoded><![CDATA[<p>תוכניות חדשות</p>
<p>(קשור לעבודה..לא מעניין בכלל)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: יובל		</title>
		<link>https://haoneg.com/temp/458#comment-180241</link>

		<dc:creator><![CDATA[יובל]]></dc:creator>
		<pubDate>Sun, 05 Oct 2008 10:35:14 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180241</guid>

					<description><![CDATA[Northern Lights]]></description>
			<content:encoded><![CDATA[<p>Northern Lights</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: חמוטל		</title>
		<link>https://haoneg.com/temp/458#comment-180235</link>

		<dc:creator><![CDATA[חמוטל]]></dc:creator>
		<pubDate>Sun, 05 Oct 2008 08:05:06 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180235</guid>

					<description><![CDATA[תחשבו רגע איך ייראו הדיונים באסיפה, אם יהיה נוהל קבוע ששבוע לפני האסיפה יעלו ההצעות לסדר היום בפורום ויאפשרו דיון מקדים לפני האסיפה בפועל.

תחשבו רגע איזה עושר דעות אפשר לקבל בתהליך של בחינת התקנון וניסוח מחודש של ערכי הכפר, אם לפני כל ערב דיון יתקיים דיון מקדים בפורום.


(כמה פאתוס.....לשכנע אנשים להיכנס לפורום של היישוב.. מבדר)]]></description>
			<content:encoded><![CDATA[<p>תחשבו רגע איך ייראו הדיונים באסיפה, אם יהיה נוהל קבוע ששבוע לפני האסיפה יעלו ההצעות לסדר היום בפורום ויאפשרו דיון מקדים לפני האסיפה בפועל.</p>
<p>תחשבו רגע איזה עושר דעות אפשר לקבל בתהליך של בחינת התקנון וניסוח מחודש של ערכי הכפר, אם לפני כל ערב דיון יתקיים דיון מקדים בפורום.</p>
<p>(כמה פאתוס&#8230;..לשכנע אנשים להיכנס לפורום של היישוב.. מבדר)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: ענת		</title>
		<link>https://haoneg.com/temp/458#comment-180225</link>

		<dc:creator><![CDATA[ענת]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 22:24:22 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180225</guid>

					<description><![CDATA[http://www.pimsleurapproach.com/learn-russian.asp

המלצתי לחברה ללמוד רוסית דרך הקורסים להאזנה של פימסלר, בתקופתו הייתי מקשיבה להם במפ3 שלי כשהיה נמאס לי ממוזיקה ועכשיו אם אקלע למוסקבה לפחות אדע לשאול &quot;סליחה אדוני, איפה הכיכר האדומה\רחוב טברסקייה?&quot;]]></description>
			<content:encoded><![CDATA[<p><a href="http://www.pimsleurapproach.com/learn-russian.asp" rel="nofollow ugc">http://www.pimsleurapproach.com/learn-russian.asp</a></p>
<p>המלצתי לחברה ללמוד רוסית דרך הקורסים להאזנה של פימסלר, בתקופתו הייתי מקשיבה להם במפ3 שלי כשהיה נמאס לי ממוזיקה ועכשיו אם אקלע למוסקבה לפחות אדע לשאול &quot;סליחה אדוני, איפה הכיכר האדומה\רחוב טברסקייה?&quot;</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: עמית		</title>
		<link>https://haoneg.com/temp/458#comment-180218</link>

		<dc:creator><![CDATA[עמית]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 21:05:08 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180218</guid>

					<description><![CDATA[http://www.youtube.com/watch?v=TRVjfKOeIxU]]></description>
			<content:encoded><![CDATA[<p><iframe class="youtube-player" width="640" height="360" src="https://www.youtube.com/embed/TRVjfKOeIxU?version=3&#038;rel=1&#038;showsearch=0&#038;showinfo=1&#038;iv_load_policy=1&#038;fs=1&#038;hl=he-IL&#038;autohide=2&#038;wmode=transparent" allowfullscreen="true" style="border:0;" sandbox="allow-scripts allow-same-origin allow-popups allow-presentation"></iframe></p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: תומר		</title>
		<link>https://haoneg.com/temp/458#comment-180217</link>

		<dc:creator><![CDATA[תומר]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 20:53:35 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180217</guid>

					<description><![CDATA[Eclipse Tech Support [techsupport@lao.ten.fujits]]></description>
			<content:encoded><![CDATA[<p>Eclipse Tech Support [techsupport@lao.ten.fujits</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: Gong		</title>
		<link>https://haoneg.com/temp/458#comment-180214</link>

		<dc:creator><![CDATA[Gong]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 19:41:24 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180214</guid>

					<description><![CDATA[The Midnight Meat Train]]></description>
			<content:encoded><![CDATA[<p>The Midnight Meat Train</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: גלעד		</title>
		<link>https://haoneg.com/temp/458#comment-180211</link>

		<dc:creator><![CDATA[גלעד]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 19:18:43 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180211</guid>

					<description><![CDATA[group_velocity]]></description>
			<content:encoded><![CDATA[<p>group_velocity</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: Sarita		</title>
		<link>https://haoneg.com/temp/458#comment-180207</link>

		<dc:creator><![CDATA[Sarita]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 18:12:42 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180207</guid>

					<description><![CDATA[footage]]></description>
			<content:encoded><![CDATA[<p>footage</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: עופר		</title>
		<link>https://haoneg.com/temp/458#comment-180205</link>

		<dc:creator><![CDATA[עופר]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 18:08:31 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180205</guid>

					<description><![CDATA[adrian belew
(מעדכן טאגים בווינאמפ)]]></description>
			<content:encoded><![CDATA[<p>adrian belew<br />
(מעדכן טאגים בווינאמפ)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: מיקי שמיקי		</title>
		<link>https://haoneg.com/temp/458#comment-180195</link>

		<dc:creator><![CDATA[מיקי שמיקי]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 16:50:55 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180195</guid>

					<description><![CDATA[D:\Pics\My Pictures\Sony\30.8.08]]></description>
			<content:encoded><![CDATA[<p>D:\Pics\My Pictures\Sony\30.8.08</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: שירה		</title>
		<link>https://haoneg.com/temp/458#comment-180192</link>

		<dc:creator><![CDATA[שירה]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 16:33:44 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180192</guid>

					<description><![CDATA[2000.12.31 (לעזאזל, משהו מהעבודה)]]></description>
			<content:encoded><![CDATA[<p>2000.12.31 (לעזאזל, משהו מהעבודה)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: יגאל		</title>
		<link>https://haoneg.com/temp/458#comment-180190</link>

		<dc:creator><![CDATA[יגאל]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 15:59:45 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180190</guid>

					<description><![CDATA[http://www.text.org.il/07_covers/0701092.jpg]]></description>
			<content:encoded><![CDATA[<p><a href="http://www.text.org.il/07_covers/0701092.jpg" rel="nofollow ugc">http://www.text.org.il/07_covers/0701092.jpg</a></p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: א. סופרמן		</title>
		<link>https://haoneg.com/temp/458#comment-180189</link>

		<dc:creator><![CDATA[א. סופרמן]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 15:13:48 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180189</guid>

					<description><![CDATA[יא שמעון]]></description>
			<content:encoded><![CDATA[<p>יא שמעון</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: ברך		</title>
		<link>https://haoneg.com/temp/458#comment-180188</link>

		<dc:creator><![CDATA[ברך]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 14:59:11 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180188</guid>

					<description><![CDATA[(blank?)]]></description>
			<content:encoded><![CDATA[<p>(blank?)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: מיכאל		</title>
		<link>https://haoneg.com/temp/458#comment-180186</link>

		<dc:creator><![CDATA[מיכאל]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 14:30:13 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180186</guid>

					<description><![CDATA[היי, 

 
מה קורה?

 

אני לא נוהגת לעשות זאת, אבל בכל זאת.

אחותו של ידיד שלי מחפשת עבודה במשרד פרסום. 

אולי יש לכם איזה תפקיד בשבילה?

 

תעביר לגורמים הרלוונטיים.]]></description>
			<content:encoded><![CDATA[<p>היי, </p>
<p>מה קורה?</p>
<p>אני לא נוהגת לעשות זאת, אבל בכל זאת.</p>
<p>אחותו של ידיד שלי מחפשת עבודה במשרד פרסום. </p>
<p>אולי יש לכם איזה תפקיד בשבילה?</p>
<p>תעביר לגורמים הרלוונטיים.</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: אור		</title>
		<link>https://haoneg.com/temp/458#comment-180185</link>

		<dc:creator><![CDATA[אור]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 14:24:54 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180185</guid>

					<description><![CDATA[Good morning starshine]]></description>
			<content:encoded><![CDATA[<p>Good morning starshine</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: שירה ז.		</title>
		<link>https://haoneg.com/temp/458#comment-180184</link>

		<dc:creator><![CDATA[שירה ז.]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 14:09:58 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180184</guid>

					<description><![CDATA[http://www.youtube.com/watch?v=7-NOZU2iPA8


)החלטתי שאם חזרתי לקרוא אני צריכה שוב לקייפסט(]]></description>
			<content:encoded><![CDATA[<p><a href="http://www.youtube.com/watch?v=7-NOZU2iPA8" rel="nofollow ugc">http://www.youtube.com/watch?v=7-NOZU2iPA8</a></p>
<p>)החלטתי שאם חזרתי לקרוא אני צריכה שוב לקייפסט(</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: פטריק פול		</title>
		<link>https://haoneg.com/temp/458#comment-180182</link>

		<dc:creator><![CDATA[פטריק פול]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 13:47:54 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180182</guid>

					<description><![CDATA[parsnip

כשאתה מנסה לעקוב אחרי מתכונים זרים, תמיד יצוץ לך מרכיב שאתה לא מכיר. ולא משנה מה רמת האנגלית שלך; מרפי מקולל כזה. אז &quot;parsnip&quot; זה גזר לבן, למי שיצא לו להתקל בזה בעתיד. בתאבון. 
(תהיתי מה יצא)]]></description>
			<content:encoded><![CDATA[<p>parsnip</p>
<p>כשאתה מנסה לעקוב אחרי מתכונים זרים, תמיד יצוץ לך מרכיב שאתה לא מכיר. ולא משנה מה רמת האנגלית שלך; מרפי מקולל כזה. אז &quot;parsnip&quot; זה גזר לבן, למי שיצא לו להתקל בזה בעתיד. בתאבון.<br />
(תהיתי מה יצא)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: אורי ב"ד		</title>
		<link>https://haoneg.com/temp/458#comment-180181</link>

		<dc:creator><![CDATA[אורי ב"ד]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 13:25:35 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180181</guid>

					<description><![CDATA[http://einat.sf-f.org.il/

(אתר פרס עינת שבו הוכרז על תחרות חביב הקהל - בתקווה שגיאחה יציין זאת באופן מסודר)]]></description>
			<content:encoded><![CDATA[<p><a href="http://einat.sf-f.org.il/" rel="nofollow ugc">http://einat.sf-f.org.il/</a></p>
<p>(אתר פרס עינת שבו הוכרז על תחרות חביב הקהל &#8211; בתקווה שגיאחה יציין זאת באופן מסודר)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: רן		</title>
		<link>https://haoneg.com/temp/458#comment-180180</link>

		<dc:creator><![CDATA[רן]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 13:08:32 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180180</guid>

					<description><![CDATA[
function doPay(f, payId)
{
	f.all.item(&quot;payId&quot;).value = payId;
	f.submit();
}


עבודה, מה לעשות...]]></description>
			<content:encoded><![CDATA[<p>function doPay(f, payId)<br />
{<br />
	f.all.item(&quot;payId&quot;).value = payId;<br />
	f.submit();<br />
}</p>
<p>עבודה, מה לעשות&#8230;</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: תמר		</title>
		<link>https://haoneg.com/temp/458#comment-180179</link>

		<dc:creator><![CDATA[תמר]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 13:05:17 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180179</guid>

					<description><![CDATA[Undo
Undo
Undo
Undo
Undo
Undo
Undo
Undo
Undo
Undo
Undo
Undo
Undo
Undo
Undo
Undo
Undo
Undo

מה היתה הפעולה האחרונה ?]]></description>
			<content:encoded><![CDATA[<p>Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo<br />
Undo</p>
<p>מה היתה הפעולה האחרונה ?</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: יואב		</title>
		<link>https://haoneg.com/temp/458#comment-180178</link>

		<dc:creator><![CDATA[יואב]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 12:58:02 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180178</guid>

					<description><![CDATA[Yoav Kedem wrote
at 3:36pm
איזה עופרק&#039;ה זה!
יא אללה :D

[תגובה על תמונה בפייסבוק]]]></description>
			<content:encoded><![CDATA[<p>Yoav Kedem wrote<br />
at 3:36pm<br />
איזה עופרק'ה זה!<br />
יא אללה 😀</p>
<p>[תגובה על תמונה בפייסבוק]</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: redgirl		</title>
		<link>https://haoneg.com/temp/458#comment-180177</link>

		<dc:creator><![CDATA[redgirl]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 12:47:52 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180177</guid>

					<description><![CDATA[במסגרת הפסטיבל יתקיים בר תיאטרון בו יש במה לסטודנטים הרוצים להציג את כישוריהם ויצירתם. אנו מחפשים סרטים קצרים, עבודות וידאו, סיפורים קצרים ושירים. בקשתי אליכם היא שתעבירו לסטודנטים בחוגים שלכם פנייה ישירה.  זו תהיה השנה השביעית ברציפות בה מתקיים פסטיבל סמול במה והוא זוכה לחשיפה גדולה יותר משנה לשנה. אודה לכם על העזרה בפרסומו  במידה ויש לכם שאלות או בקשות אנא פנו אליי.
הפסטיבל יתקיים כל יום במהלך השבוע הראשון לשנת הלימודים 2.11-6.11 משעה 18:15- 23:15.
בתודה ובברכת שנה טובה,
הגר מפיקה
rhagar@gmail.com

(מתוך מכתב לנציגים באגודת הסטודנטים. קיצרתי קצת ושיניתי כדי לשלוח לסטודנטית שלומדת במסלול כתיבה יוצרת שתפיץ... כולם מוזמנים אגב. לפסטיבל עצמו אבל גם להשתתף. אך נציג של האגודה אגב, לא חזר אליי. הם גם בטח לא הפיצו את המכתב. מרגיז.)]]></description>
			<content:encoded><![CDATA[<p>במסגרת הפסטיבל יתקיים בר תיאטרון בו יש במה לסטודנטים הרוצים להציג את כישוריהם ויצירתם. אנו מחפשים סרטים קצרים, עבודות וידאו, סיפורים קצרים ושירים. בקשתי אליכם היא שתעבירו לסטודנטים בחוגים שלכם פנייה ישירה.  זו תהיה השנה השביעית ברציפות בה מתקיים פסטיבל סמול במה והוא זוכה לחשיפה גדולה יותר משנה לשנה. אודה לכם על העזרה בפרסומו  במידה ויש לכם שאלות או בקשות אנא פנו אליי.<br />
הפסטיבל יתקיים כל יום במהלך השבוע הראשון לשנת הלימודים 2.11-6.11 משעה 18:15- 23:15.<br />
בתודה ובברכת שנה טובה,<br />
הגר מפיקה<br />
<a href="mailto:rhagar@gmail.com">rhagar@gmail.com</a></p>
<p>(מתוך מכתב לנציגים באגודת הסטודנטים. קיצרתי קצת ושיניתי כדי לשלוח לסטודנטית שלומדת במסלול כתיבה יוצרת שתפיץ&#8230; כולם מוזמנים אגב. לפסטיבל עצמו אבל גם להשתתף. אך נציג של האגודה אגב, לא חזר אליי. הם גם בטח לא הפיצו את המכתב. מרגיז.)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: שגיאB		</title>
		<link>https://haoneg.com/temp/458#comment-180175</link>

		<dc:creator><![CDATA[שגיאB]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 12:44:01 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180175</guid>

					<description><![CDATA[http://www.youtube.com/experiencewii]]></description>
			<content:encoded><![CDATA[<p><a href="http://www.youtube.com/experiencewii" rel="nofollow ugc">http://www.youtube.com/experiencewii</a></p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: יפתח כרמלי		</title>
		<link>https://haoneg.com/temp/458#comment-180174</link>

		<dc:creator><![CDATA[יפתח כרמלי]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 12:39:33 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180174</guid>

					<description><![CDATA[Though i&#039;m past one hundred thousand miles, i&#039;m feeling very still



נראה אתכם מזהים את השיר! ]]></description>
			<content:encoded><![CDATA[<p>Though i'm past one hundred thousand miles, i'm feeling very still</p>
<p>נראה אתכם מזהים את השיר! </p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: סיגל		</title>
		<link>https://haoneg.com/temp/458#comment-180173</link>

		<dc:creator><![CDATA[סיגל]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 12:35:55 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180173</guid>

					<description><![CDATA[http://www.mfa.gov.il/MFAHEB]]></description>
			<content:encoded><![CDATA[<p><a href="http://www.mfa.gov.il/MFAHEB" rel="nofollow ugc">http://www.mfa.gov.il/MFAHEB</a></p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: Danny-L		</title>
		<link>https://haoneg.com/temp/458#comment-180172</link>

		<dc:creator><![CDATA[Danny-L]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 12:18:30 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180172</guid>

					<description><![CDATA[http://tinyurl.com/4a7wem]]></description>
			<content:encoded><![CDATA[<p><a href="http://tinyurl.com/4a7wem" rel="nofollow ugc">http://tinyurl.com/4a7wem</a></p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: נטע-לי		</title>
		<link>https://haoneg.com/temp/458#comment-180171</link>

		<dc:creator><![CDATA[נטע-לי]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 12:15:47 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180171</guid>

					<description><![CDATA[כן, עדיין צריכה גברבר חסו.ן כאילו היו כמה הצעות אבל העובדה היא שהשידה עוד עומדת במקומה‬
  ‫החלטתי שאני אסדר ואנקה קודם את החדר שהיא מיועדת להיכנס אליו לפני כן :P‬

(מתוך שיחת גוגל שנותקה כל הזמן)]]></description>
			<content:encoded><![CDATA[<p>כן, עדיין צריכה גברבר חסו.ן כאילו היו כמה הצעות אבל העובדה היא שהשידה עוד עומדת במקומה‬<br />
  ‫החלטתי שאני אסדר ואנקה קודם את החדר שהיא מיועדת להיכנס אליו לפני כן :P‬</p>
<p>(מתוך שיחת גוגל שנותקה כל הזמן)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: אדוה		</title>
		<link>https://haoneg.com/temp/458#comment-180170</link>

		<dc:creator><![CDATA[אדוה]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 12:15:16 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180170</guid>

					<description><![CDATA[&quot;I am an accident waiting to happen&quot;

(ציטטתי דרסדן דולז למישהי)]]></description>
			<content:encoded><![CDATA[<p>&quot;I am an accident waiting to happen&quot;</p>
<p>(ציטטתי דרסדן דולז למישהי)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: ג'ים		</title>
		<link>https://haoneg.com/temp/458#comment-180169</link>

		<dc:creator><![CDATA[ג'ים]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 12:04:03 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180169</guid>

					<description><![CDATA[And I remember quiet evenings trembling close to you...

(טום וויטס מביע את רגשותיי)]]></description>
			<content:encoded><![CDATA[<p>And I remember quiet evenings trembling close to you&#8230;</p>
<p>(טום וויטס מביע את רגשותיי)</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		מאת: רודד בהט		</title>
		<link>https://haoneg.com/temp/458#comment-180168</link>

		<dc:creator><![CDATA[רודד בהט]]></dc:creator>
		<pubDate>Sat, 04 Oct 2008 11:56:44 +0000</pubDate>
		<guid isPermaLink="false">http://haoneg.com/?p=458#comment-180168</guid>

					<description><![CDATA[Caos Calmo]]></description>
			<content:encoded><![CDATA[<p>Caos Calmo</p>
]]></content:encoded>
		
			</item>
	</channel>
</rss>
