4 באוקטובר 2008

עד העונג הבא: תת מודע מחשבי

הלו, ליידיז אנד ג'רמז. המהדורה השבועית של העונג שבת תעלה רק בשבת, יען כי עכשיו כבר שלוש בלילה ועוד לא סיימתי לערוך אותה וצריך לישון (מחר מקליטים עונג סשן בצהריים!).

בינתיים, נשחק במשחק שהומצא כאן (אני חושב) לפני שנים ועכשיו קם מן המתים בזרועות שלוחות קדימה וממלמל "brains… brains…" – כן, חברים וחתיכות, מדובר במשחק החביב עלינו תת מודע מחשבי! מה הרעיון? מתישהו לפני שהגעתם לפוסט הזה, עשיתם לטקסט כלשהו "העתק". עכשיו רוצו לתגובות, תלחצו רק "הדבק" ופרסמו – בלי תוספות! זהו התת-מודע המחשבי שלכם.

העונג יגיע באיזור מוצ"ש. מצער, אבל מה לעשות, יש אילוצים. בינתיים, רוצו לתגובות ותביאו אותה באיזה CTRL + V חגיגי, ונראה מה יצא לכם!

[אני מזכיר: אם יוצא לכם שם משהו ארוך בצורה קיצונית, קצרו אותו בבקשה. העמוד של הפוסט צריך להיות קריא ואם יש שם תגובה שאורכה חצי עולם, זה מעצבן. ואם שמתם משהו טכני – הוסיפו סוגריים בסוף ותסבירו מה זה, לסקרנים.]

101 תגובות על “עד העונג הבא: תת מודע מחשבי”

  1. מאת שירה ז.:

    נירקוש – סליחה שלא חזרתי אליך!

  2. http://www.flix.co.il/tapuz/showVideo.asp?m=2772599

    מצטער, אבל באמת שלחתי את זה…
    "שבוע סוף" (או איך שלא קוראים לתוכנית "בידור" הזו בערוץ 2) העתיקו מאיתנו באופן בוטה את הרעיון של זאב רווח שמככב בסרט-פעולה…
    אצלהם הוא שיחק את ה"צחוקר", הנמסיס של סופר-גבר, אבל אפשר לראות את הדמיון..
    שלחתי למישהו לינק לסרטון שלנו. ועכשיו עשיתי CTRL+V לבקשתך..

    לילה טוב.

  3. מאת עידו:

    "כשנשים יפסיקו לסחוב איתן מראות לכלמקום שהן הולכות, אולי אז הן יוכלו לדבר איתי על חירות."

  4. מאת Shira-K:

    ניסיתי ויצא טקסט שלי. משהו על הרהורי-מעבר, מכתבי קבלה לימודים, חוסר-עוגן ותיעוב לעיר.
    זה לא לכאן, מן הסתם, אז תדמיינו.

  5. מאת רן:

    http://www.thebeijinger.com/classifieds/employment/feed

    גיליתי את נפלאות הסינדיקציה לא מזמן…

  6. מאת יותם:

    אה, אולי היה כדאי לציין ששלי NSFW

  7. מאת החגב עומד יציב:

    http://www.imdb.com/title/tt0119273/
    נראה לי מעניין,אני יודע.

  8. מאת מרתפיש:

    בית המוסיקה , עיריית חיפה

  9. מאת רוני דורי:

    http://vacation.new-york-apartment.com/en/description/2627393-east-7th-street-apartment/

    הדירה שאשהה בה באיסט ווילג' בשבוע הקרוב!

    שבת שלום.

  10. מאת דולי:

    כאן הוא יצק את יסודות הפוסט-מודרניות של ימינו בכך שהנהיג את רעיון בניית העולם ע"י המושגים והשפה, רעיון אשר מטעמים נסתרים הפך 150 שנה אחריו לשיא התגלית והעומק של הלהג הפוסט-מודרני. על בסיס זה הוא ניגש ישירות אל הצידוק הלוגי החמור של האמונות שנחשבו לתפלות ע"י הוגי הנאורות, כמו נפרדות הנפש, חירותה ונצחיותה בעולם הבא, וקיומו של אלוהים על כל תכונותיו ותאריו המסורתיים. בכך הפך קאנט למבשרה של תקופת החשיכה והדרדור התרבותי והפילוסופי שהחלה עם מותו בראשית במאה ה-19 ונשארה מתוחזקת עד ימינו ע"י ממשיכיו.

    (ש.ה. ברגמן מסביר למה קאנט הוא בעצם מחריב הנאורות, ולא המייצג שלה)
    (תסתכלו באיזו שעה פרסמתי את התגובה הזו ותבינו במה אני מתעסקת בשבת בבוקר. ייאוש)

  11. מאת פלג דניאל:

    The.Wire.S01E0

    החלטתי להתחיל לראות את הסדרה הזאת….

  12. מאת סופיה:

    כדורי בשר ברוטב חלב קוקוס, קארי ירוק ואפונה

  13. מאת ערן:

    66000000000

    (כן. אני יודע.)

  14. מאת Sarita:

    Bjork just got the news.

    She has announced that she will release 10 new box sets to Iceland in two weeks for Icelandic fans!

  15. מאת שלוצקי:

    (אנחנו הלהקה הכי חננה בעולם, עדיף לך ללכת לאליפות מתנסים בשחמט)

    – כנראה נשאר בזיכרון משיחת גוגל טוק אתמול בלילה שנותקה וחוברה כל הזמן

  16. מאת הילה:

    http://www.youtube.com/watch?v=blUjrxe8dAA&feature=related
    (הבחור עם העיניים הכי יפות בשיינקין)

  17. מאת ינשוף:

    http://www.megaupload.com/?d=Y5OW12J0
    מטאליקה מבצעים חי 2 שירים של בלאק סאבאת המנוחה.
    עוד לא בדקתי איך יצא להם, בקורות מישהו?

  18. מאת yaddo:

    (לא קופי+פייסט) פלג דניאל, אני מאוד מקווה שאתה רואה הסמויה עם תרגום, כי אחרת פשוט לא תבין המון דברים, אלא אם כן אתה באמת יחיד סגולה. היא מורכבת מאוד, עמוסה בעגת שחורים ומונחים פוליטיים מסובכים להפליא, ולא מדובר בסדרה שכדאי להבין בה דברים לפי הקשר או משהו – בהרבה מהמקרים היא שירה לשמה. מייקל סקוט מהמשרד העיד שהוא לא מבין מילה ממנה, ואנגלית היא שפת האם שלו! וגם מישהי פחות פיקטיבית ממקום העבודה שלי שאנגלית היא שפת אמה, אמרה לי שזוהי הסדרה היחידה שבה היא באמת רצתה שיהיו כתוביות בעברית. לתשומת לבך.

  19. מאת Pygmy puff:

    Après moi le déluge

    (מהשיר של רג'ינה, ובכלל)

  20. מאת בעעע:

    Untitled (2007)

    35X20 cm

    pen on paper

  21. מאת א.ס.:

    דוס גמד. תדמיין דוס גמד!

    [אני לא מפברקת. בחיי שזה מה שיצא.]

  22. http://davidhonl.blogspot.com/2008/05/usa-today-does-it-strobist-style.html

    שועל האש משום מה לא הסכים להריץ לי את זה, אז נאלצתי להעתיק את זה למגלה/חוקר האינטרנט.

  23. מאת איילת:

    הובס, לויתן, פרק י', עמ' 80

  24. מאת א' נדב:

    His two handed handshake
    Says he's so glad to meet you
    His one silver earring
    Says he parties on weekends

    He churns through the channels
    When he's watching the TV
    He recites lines from movies
    When he's trying to be funny

    [חתכתי את ההמשך. אלה המילים לשיר Two Handed Handshake של ההולד סטדי שהיזנתי לליריקס פלאגין של ווינאמפ. הייתי אמור לראות אותם בברלין עוד שלושה שבועות אך כרגע חרב עליי עולמי כשגיליתי שההופעה התבטלה בגלל שהגיטריסט חולה בדלקת הלבלב. נו טוב, לפחות אני אראה את אוף מונטריאול.]

  25. מאת samani:

    http://www.youtube.com/watch?v=ovJmy5Ioc_Q

    (לכל מי שחשב שהוא יודע למה קראו להם "איפה הילד")

  26. מאת פלג דניאל:

    ל – YADDO תודה על הערה, התחלתי לראות כמה דקות מהפרק הראשון (דו שיח בין כנראה בלש לבחור מהשכונה ) וכבר ממספר הדקות האלה הבנתי שאני צריך לפנות לי זמן ולראות את זה כמו שצריך…

  27. מאת איילון צפון:

    כ

    כן, זהו.

  28. מאת June:

    אני זזה לאכול

  29. מאת עומר:

    Julien Doré & Carla Bruni – Anyone Else But You

  30. מאת אייל:

    Arp Solina String Ensemble

    (אחד מהכלים בו השתמש אחד החברים ב-Air בהופעות בארץ)

  31. מאת סתם אחד:

    i hope your having a nice holiday..

  32. מאת דנה:

    These Boots Are made For Walking

    [שיר שהקומונה/אנסמבל שלי יבצע בפסטיבל עכו בהצגת רחוב. בואו בהמוניכם]

  33. מאת דניאל:

    Thao with the Get Down Stay Down

  34. מאת עדי:

    ואולי אין לנו די זמן לעקור הרים
    אבל יש לנו מספיק זמן לכתוב שירים
    על הזכות הגדולה להיות פה
    על הזכות הגדולה לומר לא
    אני עבד, מוות לסמלת

  35. מאת חן:

    שמ"ג תשתתף בפיילוט בן החצי שעה של "The Wonderful Maladys", דרמה-קומית חדשה של HBO על משפחה לא מתפקדת של שלושה אחים שאיבדו את הוריהם בגיל צעיר.
    היוצר, צ'ארלס רודולף, כתב את הדמות לשמ"ג והתסריט נקנה ע"י HBO במטרה לצלם את הפיילוט בתחילת השנה הבאה.
    במידה והסידרה תצא לפועל, שניהם ישמשו גם בתור מפיקים בפועל של הסידרה.

    [או, כן, העתקתי מפורום כלשהו למישהו במסנג'ר. דווקא פיסת מידע מעניינת.]

  36. מאת בועז כהן:

    שי, הנה התמונה של בריז'יט ברדו ערומה, מ-1973, שהבטחתי לך

    http://www.celebs-hookers.com/Brigitt_Bardot/Brigitt_Bardot14.jpg

  37. מאת ט.פייסיק:

    Incredible 90 minute interview with legendary rock critic Lester Bangs from 1980. Lester speaks about factors within the music industry, New Wave, Punk, CBGB's & music journalism.

    http://interviewsarchive.com/catalogue.htm

  38. מאת עידו שחם:

    M8R-jpjtl31@mailinator.com [כתובת מייל זמנית לספאם של האתר Mailinator.com. השתמשתי בזה הפעם כדי להרשם לאתר של רקעי מנגה לדסקטופ]. תפגיזו אותה בספאם בהמוניכים!

  39. מאת נט:

    ככה מתכוננים לנסיעה לברלין :)
    We meet at 11.00am each morning at Alexander Platz tv tower next to TV
    tower entrance at seating area of Starbucks coffee.We operate all year round.

    The tour utilizes the incredibly efficent Berlin transport system.

  40. מאת רודד בהט:

    Caos Calmo

  41. מאת ג'ים:

    And I remember quiet evenings trembling close to you…

    (טום וויטס מביע את רגשותיי)

  42. מאת אדוה:

    "I am an accident waiting to happen"

    (ציטטתי דרסדן דולז למישהי)

  43. מאת נטע-לי:

    כן, עדיין צריכה גברבר חסו.ן כאילו היו כמה הצעות אבל העובדה היא שהשידה עוד עומדת במקומה‬
    ‫החלטתי שאני אסדר ואנקה קודם את החדר שהיא מיועדת להיכנס אליו לפני כן :P‬

    (מתוך שיחת גוגל שנותקה כל הזמן)

  44. Though i'm past one hundred thousand miles, i'm feeling very still

    נראה אתכם מזהים את השיר!

  45. מאת redgirl:

    במסגרת הפסטיבל יתקיים בר תיאטרון בו יש במה לסטודנטים הרוצים להציג את כישוריהם ויצירתם. אנו מחפשים סרטים קצרים, עבודות וידאו, סיפורים קצרים ושירים. בקשתי אליכם היא שתעבירו לסטודנטים בחוגים שלכם פנייה ישירה. זו תהיה השנה השביעית ברציפות בה מתקיים פסטיבל סמול במה והוא זוכה לחשיפה גדולה יותר משנה לשנה. אודה לכם על העזרה בפרסומו במידה ויש לכם שאלות או בקשות אנא פנו אליי.
    הפסטיבל יתקיים כל יום במהלך השבוע הראשון לשנת הלימודים 2.11-6.11 משעה 18:15- 23:15.
    בתודה ובברכת שנה טובה,
    הגר מפיקה
    rhagar@gmail.com

    (מתוך מכתב לנציגים באגודת הסטודנטים. קיצרתי קצת ושיניתי כדי לשלוח לסטודנטית שלומדת במסלול כתיבה יוצרת שתפיץ… כולם מוזמנים אגב. לפסטיבל עצמו אבל גם להשתתף. אך נציג של האגודה אגב, לא חזר אליי. הם גם בטח לא הפיצו את המכתב. מרגיז.)

  46. מאת יואב:

    Yoav Kedem wrote
    at 3:36pm
    איזה עופרק'ה זה!
    יא אללה 😀

    [תגובה על תמונה בפייסבוק]

  47. מאת תמר:

    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo
    Undo

    מה היתה הפעולה האחרונה ?

  48. מאת רן:

    function doPay(f, payId)
    {
    f.all.item("payId").value = payId;
    f.submit();
    }

    עבודה, מה לעשות…

  49. מאת אורי ב"ד:

    http://einat.sf-f.org.il/

    (אתר פרס עינת שבו הוכרז על תחרות חביב הקהל – בתקווה שגיאחה יציין זאת באופן מסודר)

  50. מאת פטריק פול:

    parsnip

    כשאתה מנסה לעקוב אחרי מתכונים זרים, תמיד יצוץ לך מרכיב שאתה לא מכיר. ולא משנה מה רמת האנגלית שלך; מרפי מקולל כזה. אז "parsnip" זה גזר לבן, למי שיצא לו להתקל בזה בעתיד. בתאבון.
    (תהיתי מה יצא)

  51. מאת שירה ז.:

    http://www.youtube.com/watch?v=7-NOZU2iPA8

    )החלטתי שאם חזרתי לקרוא אני צריכה שוב לקייפסט(

  52. מאת אור:

    Good morning starshine

  53. מאת מיכאל:

    היי,

    מה קורה?

    אני לא נוהגת לעשות זאת, אבל בכל זאת.

    אחותו של ידיד שלי מחפשת עבודה במשרד פרסום.

    אולי יש לכם איזה תפקיד בשבילה?

    תעביר לגורמים הרלוונטיים.

  54. מאת א. סופרמן:

    יא שמעון

  55. מאת שירה:

    2000.12.31 (לעזאזל, משהו מהעבודה)

  56. D:\Pics\My Pictures\Sony\30.8.08

  57. מאת עופר:

    adrian belew
    (מעדכן טאגים בווינאמפ)

  58. מאת גלעד:

    group_velocity

  59. מאת Gong:

    The Midnight Meat Train

  60. מאת תומר:

    Eclipse Tech Support [techsupport@lao.ten.fujits

  61. מאת ענת:

    http://www.pimsleurapproach.com/learn-russian.asp

    המלצתי לחברה ללמוד רוסית דרך הקורסים להאזנה של פימסלר, בתקופתו הייתי מקשיבה להם במפ3 שלי כשהיה נמאס לי ממוזיקה ועכשיו אם אקלע למוסקבה לפחות אדע לשאול "סליחה אדוני, איפה הכיכר האדומה\רחוב טברסקייה?"

  62. מאת חמוטל:

    תחשבו רגע איך ייראו הדיונים באסיפה, אם יהיה נוהל קבוע ששבוע לפני האסיפה יעלו ההצעות לסדר היום בפורום ויאפשרו דיון מקדים לפני האסיפה בפועל.

    תחשבו רגע איזה עושר דעות אפשר לקבל בתהליך של בחינת התקנון וניסוח מחודש של ערכי הכפר, אם לפני כל ערב דיון יתקיים דיון מקדים בפורום.

    (כמה פאתוס…..לשכנע אנשים להיכנס לפורום של היישוב.. מבדר)

  63. מאת יובל:

    Northern Lights

  64. מאת מני:

    תוכניות חדשות

    (קשור לעבודה..לא מעניין בכלל)

  65. מאת שירה:

    Napoleon Dynamite (2004)

  66. מאת rooster:

    לבקשת עודד נונברג-
    התקנת
    IXOS Viewer
    למשתמש
    לפי הנוהל בלינק הבא:

  67. מאת amir:

    Conversations with Other Women

    (סרט רע, רע רע)

  68. מאת אלון:

    ולאנמיה. כתישת זרעים קלויים לריפוי פצעים ולהפסקת דימום מהאף.

  69. מאת רועי:

    ccrma.stanford.edu

  70. מאת אלריק:

    GGGCATATGGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGCATGGGTCGCCCGACAGAACGACGCCCGGCCGCCGC

    (חתיכה של DNA שהזמנתי ועלתה לאונ' בן גוריון 282.60 כולל מע"מ)

  71. מאת אלריק:

    GGGCATATGGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGCATGGGTCGCCCGACAGAACGACGCCCGGCCGCCGC

    (חתיכה של DNA שהזמנתי ועלתה לאונ' בן גוריון 282.60 ש"ח כולל מע"מ)

  72. מאת גיאחה:

    ו… נראה לי שנעצור במאה. תודה לכל המגיבים התת-מודעיים!